Photo Gallery

Login

Search

News & Updation

  • ICV
  • WJPPS Rank with Index Copernicus Value 84.65 due to high reputation at International Level

  • WJPPS DECEMBER ISSUE PUBLISHED
  • DECEMBER 2017 Issue has been successfully launched on 1 December 2017

  • WJPPS Impact Factor
  • Its our Pleasure to Inform you that WJPPS Impact Factor has been increased from 6.041 to 6.647 due to high quality Publication at International Level

  • Call for Paper
    • WJPPS  Invited to submit your valuable manuscripts for Coming Issue.
  • Updated Version
  • WJPPS introducing updated version of OSTS (online submission and tracking system), which have dedicated control panel for both author and reviewer. Using this control panel author can submit manuscript
  • Journal web site support Internet Explorer, Google Chrome, Mozilla Firefox, Opera, Saffari for easy download of article without any trouble.
  •  

Abstract

THE EFFECT OF COUPLING EFFICIENCY ON THE YIELD AND PURITY OF OLIGONUCLEOTIDES SYNTHESIZED USING PHOSPHORAMIDITE METHOD

Kandanath B. M.*, Rasheed F. and Mustafa A. S.

ABSTRACT

Coupling efficiency is a way of measuring how efficiently the DNA synthesizer is adding new bases to the growing DNA chain. To measure coupling efficiency, dimethyl trityl (DMT) group is used, which is colorless when attached to DNA base, but gives a characteristic orange color once removed upon addition of the base to the growing chain of DNA. The intensity of this color can be measured by UV spectrometry and it is directly related to the number of DMT molecules released throughout the synthesis. The aim of this study was to determine the effect of coupling efficiency on the yield and purity of the synthesized oligonucleotides by using the DNA synthesizer Mermade 12. Brucella-specific primers Forward (5’CATGCGCTATGTCTGGTTTAC3’) reverse (5’TAATAAGACTCGGCTTTGTGA3’), were arranged in the synthesis chamber with CPG standard columns C and A, respectively, with an estimated activator volume of 3.320 ml, trityl average size 10, trityl area threshold 20000. β-actin primers, forward (5’GGACTTCGAGCAAGAGATGG3’) reverse (5’AGCACTGTGTTGGCGTACAG3’), were arranged in the synthesis chamber with CPG standards columns G and G, respectively and an estimated activator volume 3.230 ml, trityl average size 10, trityl area threshold 20,000. The purity and quantity of the primers was determined by Epoch microplate spectrophotometer. Brucella-specific forward and reverse primers showed average coupling efficiencies of 99.97 and 99.95%, with a purity (OD260/280) of 1.85 and 1.84 and yields of 2456ng/μl and 2440 ng/μl, respectively. The β-actin forward and reverse primers showed average coupling efficiencies of 68% and 42%, with purities of 1.14 and 1.12 and yields of 468 and 365 ng/μl, respectively. The coupling efficiency correlates with quantity and purity of synthesized oligonucleotides. Hence, oligonucleotides with low coupling efficiency should not be used in downstream experiments.

Keywords: Mermade 12, DNA synthesizer, Coupling efficiency, Trityl value.


[Full Text Article]

Call for Paper

World Journal of Pharmacy and Pharmaceutical Sciences (WJPPS)
Read More

Online Submission

World Journal of Pharmacy and Pharmaceutical Sciences (WJPPS)
Read More

Email & SMS Alert

World Journal of Pharmacy and Pharmaceutical Sciences (WJPPS)
Read More